MirGeneDB

MirGeneDB ID

Sto-Mir-130-P4b

Family name MIR-130 (all species)
Seed AGUGCAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-130-P1b  Sto-Mir-130-P2a  Sto-Mir-130-P2b  Sto-Mir-130-P3a  Sto-Mir-130-P3b  Sto-Mir-130-P4a  Sto-Mir-130-P4o1 
Orthologues Aca-Mir-130-P4b  Ami-Mir-130-P4b  Cli-Mir-130-P4b  Cpi-Mir-130-P4b  Dre-Mir-130-P4b  Gga-Mir-130-P4b  Tgu-Mir-130-P4b  Xtr-Mir-130-P4b 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01012481.1: 68285-68351 [+]
Precursor
(pre-Mir +30nt flank)
UGCUGAGGCGAGGCUACCCUUGGAGCUGGGACCCUAUCUAUAUUGCGUCUGCUUUGAAUUUAUCGCUUUAAGUAGUGCAAUAUCGCUUAUAGGGUUUCAGCCCGGGGUCCAAUCGUCUUUCAAGAGG
Get precursor sequence
Structure
        10           20        30           40        50        60  
UGCUGAGGCGAGGCUAC---      A    GG       CU---|       U     UUGAAUUU 
                    CCUUGG GCUG  ACCCUAU     AUAUUGCG CUGCU        \
                    GGGGCC CGAC  UGGGAUA     UAUAACGU GAUGA        A
GGAGAACUUUCUGCUAACCU      -    UU       UUCGC^       -     AUUUCGCU 
     120       110        100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-130-P4b_5p*

MirBase accessionNone
Sequence
0- ACCCUAUCUAUAUUGCGUCUGCU -23
Get sequence
Mature sequence

Sto-Mir-130-P4b_3p

MirBase accessionNone
Sequence
42- UAGUGCAAUAUCGCUUAUAGGGUUU -67
Get sequence