MirGeneDB

MirGeneDB ID

Sto-Mir-10-P3a

Family name MIR-10 (all species)
Seed CCCUGAG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-10-P1a-v1  Sto-Mir-10-P1a-v2  Sto-Mir-10-P1b-v1  Sto-Mir-10-P1b-v2  Sto-Mir-10-P2a  Sto-Mir-10-P2b  Sto-Mir-10-P2c  Sto-Mir-10-P3b  Sto-Mir-10-P3c 
Orthologues Aae-Mir-10-P3  Aca-Mir-10-P3a  Ami-Mir-10-P3a  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Bta-Mir-10-P3a  Cfa-Mir-10-P3a  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cli-Mir-10-P3a  Cpi-Mir-10-P3a  Cpo-Mir-10-P3a  Cte-Mir-10-P3  Dan-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dno-Mir-10-P3a  Dpu-Mir-10-P3  Dre-Mir-10-P3a1  Dre-Mir-10-P3a2  Ete-Mir-10-P3a  Gga-Mir-10-P3a  Hsa-Mir-10-P3a  Isc-Mir-10-P3  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mdo-Mir-10-P3a  Mml-Mir-10-P3a  Mmu-Mir-10-P3a  Oan-Mir-10-P3a  Ocu-Mir-10-P3a  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Rno-Mir-10-P3a  Sha-Mir-10-P3a  Sko-Mir-10-P3  Spu-Mir-10-P3  Tca-Mir-10-P3  Tgu-Mir-10-P3a  Xtr-Mir-10-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(miRNA_loci_genome)
BFAA01000459.1: 668334-668395 [+]
Precursor
(pre-Mir +30nt flank)
CUCUUAAAUAACAAGUUGCACUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUGUGUCUCCUUAAUCCACGGGUUAGGCUCUUGGGAGCUGUGUGCUGUGCGUUGACAUCUUAAAUAGGA
Get precursor sequence
Structure
        10          20        30        40        50        60
CUCUUAAAUAACAAGUU--|   UCCUCU   UC  UG   C           AUGUGUGU 
                   GCAC      CAG  CC  AGA CCUAACUUGUG        C
                   CGUG      GUC  GG  UCU GGAUUGGGCAC        U
AGGAUAAAUUCUACAGUUG^   UCGUGU   GA  GU   C           CUAAUUCC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Sto-Mir-10-P3a_5p

MirBase accessionNone
Sequence
0- UCCCUGAGACCCUAACUUGUGA -22
Get sequence
Star sequence

Sto-Mir-10-P3a_3p*

MirBase accessionNone
Sequence
40- ACGGGUUAGGCUCUUGGGAGCU -62
Get sequence