MirGeneDB

MirGeneDB ID

Spu-Novel-5

Family name SPU-NOVEL-5 (all species)
Seed GACGGUA
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) S. purpuratus
Node of Origin (family) S. purpuratus
Genome context
(Spur_3.1)
Scaffold998: 168355-168430 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAUUUCCAGGCUGCACUCGUGGAUUUGGAGUGACGGUAGAAACAUGGAAUGCUGGUGGCCUUCUGGUCCAUACCGCCAACUGUUAUGGUCAUGUACUUGCUGGGCUCCCUUCUCGUCUUGUGAAUAUGUCUAUAAU
Get precursor sequence
Structure
        10            20        30        40         50        60       
AAUUUCCAGGCUGCACU----| U   UUU     GA      AA      A-   CU   GGCCUUCUGG 
                     CG GGA   GGAGU  CGGUAG  ACAUGG  AUG  GGU          U
                     GC UCU   CCUCG  GUCGUU  UGUACU  UAU  UCA          C
UAAUAUCUGUAUAAGUGUUCU^ -   UC-     G-      CA      GG   UG   ACCGCCAUAC 
    130       120        110         100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Novel-5_5p

MirBase accessionNone
Sequence
0- UGACGGUAGAAACAUGGAAUGCUGGU -26
Get sequence
Star sequence

Spu-Novel-5_3p*

MirBase accessionNone
Sequence
50- UGUUAUGGUCAUGUACUUGCUGGGCU -76
Get sequence