MirGeneDB

MirGeneDB ID

Spu-Novel-4

Family name SPU-NOVEL-4 (all species)
Seed AGAUCUA
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) S. purpuratus
Node of Origin (family) S. purpuratus
Genome context
(Spur_3.1)
Scaffold904: 87197-87273 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CUACACAUGUGUUUUACAAUCUAUUUUUAGAAGAUCUAGCUCGUCCAGCAGCUCGGGUGGCGAAGUCUCUUCAAAUCUUUAGGCCGCUGUGUCGUGCUAGAUCUAUAUCAAAUGAAAAGAAAGAAAACAAAAUAUUC
Get precursor sequence
Structure
        10        20        30          40         50        60       
CUACACAUGUGUUUUACAAUCUAUUUUUAGA--         U  UC-|   A  UCGGGUGGCGAAGU 
                                 AGAUCUAGC CG   CAGC GC              C
                                 UCUAGAUCG GC   GUCG CG              U
CUUAUAAAACAAAAGAAAGAAAAGUAAACUAUA         U  UGU^   C  GAUUUCUAAACUUC 
     130       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Novel-4_5p

MirBase accessionNone
Sequence
0- AAGAUCUAGCUCGUCCAGCAGC -22
Get sequence
Star sequence

Spu-Novel-4_3p*

MirBase accessionNone
Sequence
54- CGCUGUGUCGUGCUAGAUCUAUA -77
Get sequence