MirGeneDB

MirGeneDB ID

Spu-Novel-2

Family name SPU-NOVEL-2 (all species)
Seed UUUAUGA
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) S. purpuratus
Node of Origin (family) S. purpuratus
Genome context
(Spur_3.1)
Scaffold299: 164644-164707 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CAAAGUAAUACAAAUUUAUGCUCUGUCGGAUUUUAUGAUCGAGGAAGCAGAUGUGACAUUAUUAUAAGAAACACCUGCACUCUAUCAUAGAUGCCUGAAAGAGUUUUAAAUCUUCAGACGUGAA
Get precursor sequence
Structure
        10         20        30         40        50        60  
CAAAGUAAUACAAAUUUAU-     G    AU-|       C   GAA    A   GACAUUA 
                    GCUCU UCGG   UUUAUGAU GAG   GCAG UGU       U
                    UGAGA AGUC   AGAUACUA CUC   CGUC ACA       U
AAGUGCAGACUUCUAAAUUU     A    CGU^       U   A--    C   AAGAAUA 
  120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Novel-2_5p

MirBase accessionNone
Sequence
0- UUUUAUGAUCGAGGAAGCAGAUGU -24
Get sequence
Star sequence

Spu-Novel-2_3p*

MirBase accessionNone
Sequence
42- ACCUGCACUCUAUCAUAGAUGC -64
Get sequence