MirGeneDB

MirGeneDB ID

Spu-Novel-1-P2

Family name SPU-NOVEL-1 (all species)
Seed CGACUUC
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID
Paralogues Spu-Novel-1-P1 
Orthologues
Node of Origin (locus) S. purpuratus
Node of Origin (family) S. purpuratus
Genome context
(Spur_3.1)
Scaffold1061: 14703-14765 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GGAGCGAGGGACUGCACAACGGCUCAGCUGUCGACUUCCCUAGAGGGCAACAUGGAUUUCCCCAAAUGGUGUCGUUCUCGAGGGUAGUAGAUGGCUGAGCUGUUUUCAUGCAUCGCAGCAUCU
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGAGCGAGGGACUGCAC--|              G   U    A      A   UGGAUUUC 
                   AACGGCUCAGCUGUC ACU CCCU GAGGGC ACA        \
                   UUGUCGAGUCGGUAG UGA GGGA CUCUUG UGU        C
UCUACGACGCUACGUACUU^              A   U    G      C   GGUAAACC 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Novel-1-P2_5p

MirBase accessionNone
Sequence
0- UCGACUUCCCUAGAGGGCAACA -22
Get sequence
Star sequence

Spu-Novel-1-P2_3p*

MirBase accessionNone
Sequence
41- UCGUUCUCGAGGGUAGUAGAUG -63
Get sequence