MirGeneDB

MirGeneDB ID

Spu-Mir-92-o58

Family name MIR-92 (all species)
Seed AUUGCAC
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID
Paralogues Spu-Mir-92-o11  Spu-Mir-92-o12  Spu-Mir-92-o13  Spu-Mir-92-o55  Spu-Mir-92-o56  Spu-Mir-92-o57 
Orthologues Asu-Mir-92  Cel-Mir-92  Isc-Mir-92 
Node of Origin (locus) S. purpuratus
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold8342: 22471-22533 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGCUGGUGUACUAUGUUGGGGUUGUCAGAUAGGUCGUGGUGAGUGCAAUGUUCUGUUGUCUCGAAUGAAAAUAUUGCACUUACCCCGGCUUAUUUGCAGCUACCUAUCUUUGAUCUGCAUGUU
Get precursor sequence
Structure
        10           20        30        40        50        60 
GGCUGGUGUACUAUGUU--  -|    U           U               CUGUUGUC 
                   GG GGUUG CAGAUAGGUCG GGUGAGUGCAAUGUU        \
                   CC UCGAC GUUUAUUCGGC CCAUUCACGUUAUAA        U
UUGUACGUCUAGUUUCUAU  A^    -           C               AAGUAAGC 
 120       110       100         90        80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-92-o58_5p*

MirBase accessionNone
Sequence
0- AGGUCGUGGUGAGUGCAAUGUU -22
Get sequence
Mature sequence

Spu-Mir-92-o58_3p

MirBase accessionNone
Sequence
41- UAUUGCACUUACCCCGGCUUAU -63
Get sequence