MirGeneDB

MirGeneDB ID

Spu-Mir-92-o56

Family name MIR-92 (all species)
Seed AUUGCAC
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID
Paralogues Spu-Mir-92-o11  Spu-Mir-92-o12  Spu-Mir-92-o13  Spu-Mir-92-o55  Spu-Mir-92-o57  Spu-Mir-92-o58 
Orthologues Asu-Mir-92  Cel-Mir-92  Isc-Mir-92 
Node of Origin (locus) S. purpuratus
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold391: 443771-443858 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o56)
Mir-92-o12 Scaffold391: 440806-440873 [+] Ensembl
Mir-92-o13 Scaffold391: 442488-442553 [+] Ensembl
Mir-92-o11 Scaffold391: 442948-443012 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UCGUAGCUGUGAUCAUUAACCAAAUCGUGCUGGUCAGGAUGCUUGCAGUGCUGUGGCUUGCUCGUCUUAUGACGAGCAACACUAAAGCUUUCUUAGUAUUGCACUCGUCCCGGCCAGUAGGGUAUCUGGUAUAAAACAUCUUAGGCGG
Get precursor sequence
Structure
        10        20          30        40        50        60        70   
UCGUAGCUGUGAUCAUUA    A--|  G        A     CU         GUGGCUUGCUCGUCUUAUGA 
                  ACCA   AUC UGCUGGUC GGAUG  UGCAGUGCU                    C
                  UGGU   UGG AUGACCGG CCUGC  ACGUUAUGA                    G
GGCGGAUUCUACAAAAUA    CUA^  G        C     UC         UUCUUUCGAAAUCACAACGA 
      140       130       120       110       100        90        80
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-92-o56_5p*

MirBase accessionNone
Sequence
0- UGGUCAGGAUGCUUGCAGUGCU -22
Get sequence
Mature sequence

Spu-Mir-92-o56_3p

MirBase accessionNone
Sequence
66- UAUUGCACUCGUCCCGGCCAGU -88
Get sequence