MirGeneDB

MirGeneDB ID

Spu-Mir-2007-P1

Family name MIR-2007 (all species)
Seed AUUUCAG
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-2007
Paralogues Spu-Mir-2007-P2 
Orthologues Pfl-Mir-2007  Pmi-Mir-2007  Sko-Mir-2007 
Node of Origin (locus) S. purpuratus
Node of Origin (family) Ambulacraria
Genome context
(Spur_3.1)
Scaffold47: 864778-864846 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GACACCUUCAGUAUCAUCAGCAUCAUGCAUUAUUUCAGGCAGUAUACUGGUAAAGGGUUUUAUUUGCACCAUUCUUACCUGUUGCUACCUGAAAUUAAUGCAAGAUGUGUGAAUAACCCAACCCCCUUC
Get precursor sequence
Structure
        10          20        30         40        50        60    
GACACCUUCAGUAUCAUCA--     A      -|       C    U  U     AGGGUUUUAU 
                     GCAUC UGCAUU AUUUCAGG AGUA AC GGUAA          \
                     UGUAG ACGUAA UAAAGUCC UCGU UG CCAUU          U
CUUCCCCCAACCCAAUAAGUG     A      U^       A    -  U     CUUACCACGU 
       120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-2007-P1_5p

MirBase accessionMIMAT0009748
Sequence
0- UAUUUCAGGCAGUAUACUGGUAA -23
Get sequence
Star sequence

Spu-Mir-2007-P1_3p*

MirBase accessionNone
Sequence
46- ACCUGUUGCUACCUGAAAUUAAU -69
Get sequence