MirGeneDB

MirGeneDB ID

Spu-Mir-10-P2f

Family name MIR-10 (all species)
Seed ACCCGUA
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID
Paralogues Spu-Mir-10-P1  Spu-Mir-10-P2e  Spu-Mir-10-P3 
Orthologues Aae-Mir-10-P2  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dpu-Mir-10-P2  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Sko-Mir-10-P2  Tca-Mir-10-P2 
Node of Origin (locus) S. purpuratus
Node of Origin (family) Eumetazoa
Genome context
(Spur_3.1)
Scaffold22: 1059979-1060040 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUUGGUUUUCUGUUUUGUGACCUCGACUUGACCCGUAAGGUCUAAACCUGUGUCAAAGUUCAAAGGCCACAGGUUUUCAUCUUGGGGUACAAGUCUGGUGUCGCGUUUAUCUGCACUGCAU
Get precursor sequence
Structure
        10        20         30         40        50        60 
UUUUGGUUUUCUGUUUUGU   -  C      -|   G      CU        GUCAAAGU 
                   GAC CU GACUUG ACCC UAAGGU  AAACCUGU        \
                   CUG GG CUGAAC UGGG GUUCUA  UUUGGACA        U
UACGUCACGUCUAUUUGCG   U  U      A^   -      CU        CCGGAAAC 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-10-P2f_5p

MirBase accessionNone
Sequence
0- GACCCGUAAGGUCUAAACCUGU -22
Get sequence
Star sequence

Spu-Mir-10-P2f_3p* (predicted)

MirBase accessionNone
Sequence
41- AGGUUUUCAUCUUGGGGUACA -62
Get sequence