MirGeneDB

MirGeneDB ID

Spu-Mir-10-P2e

Family name MIR-10 (all species)
Seed ACCCGUA
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-2003
Paralogues Spu-Mir-10-P1  Spu-Mir-10-P2f  Spu-Mir-10-P3 
Orthologues Aae-Mir-10-P2  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dpu-Mir-10-P2  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Sko-Mir-10-P2  Tca-Mir-10-P2 
Node of Origin (locus) S. purpuratus
Node of Origin (family) Eumetazoa
Genome context
(Spur_3.1)
Scaffold22: 1063421-1063483 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACCUUAGCAGACCUGUUGCUGGUUGGCCUAAACCCGUAAGGUCUUAACUUGUGCUGGAGUUACAAGUACACAGGUUAUGCCCUUUGGGUAGUAGGCCGGACAGAAUACUCAUCGGCGAUAAAA
Get precursor sequence
Structure
        10          20        30         40        50        60 
ACCUUAGCAGACCUGUUG--   GU       A-|    U    UCU         CUGGAGU 
                    CUG  UGGCCUA  ACCCG AAGG   UAACUUGUG       \
                    GAC  GCCGGAU  UGGGU UUCC   AUUGGACAC       U
AAAAUAGCGGCUACUCAUAA   AG       GA^    -    CGU         AUGAACA 
 120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-10-P2e_5p

MirBase accessionMIMAT0009744
Sequence
0- AACCCGUAAGGUCUUAACUUGUG -23
Get sequence
Star sequence

Spu-Mir-10-P2e_3p*

MirBase accessionMIMAT0019166
Sequence
40- CAGGUUAUGCCCUUUGGGUAGUA -63
Get sequence