MirGeneDB

MirGeneDB ID

Sha-Mir-430-o9

Family name MIR-430 (all species)
Seed UUCUAAC
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID
Paralogues Sha-Mir-430-o10  Sha-Mir-430-o11  Sha-Mir-430-o12  Sha-Mir-430-o13  Sha-Mir-430-o14  Sha-Mir-430-o15  Sha-Mir-430-o16  Sha-Mir-430-o17  Sha-Mir-430-o18  Sha-Mir-430-o19  Sha-Mir-430-o20  Sha-Mir-430-o21  Sha-Mir-430-o22  Sha-Mir-430-o23  Sha-Mir-430-o24  Sha-Mir-430-o25  Sha-Mir-430-o26  Sha-Mir-430-o27  Sha-Mir-430-P1  Sha-Mir-430-P2  Sha-Mir-430-P3  Sha-Mir-430-P51 
Orthologues Hsa-Mir-430-P9a  Hsa-Mir-430-P9b  Mml-Mir-430-P9c  Mml-Mir-430-P9d  Mml-Mir-430-P9e 
Node of Origin (locus) S. harrisii
Node of Origin (family) Vertebrata
Genome context
(DEVIL7_traces)
GL850554.1: 7912-7971 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAAGCAGUAAAGAACGACCCAGCCUUGCACAUUCUAACUCUGAGCACUUAUUGGAUAUGUAAGAAGCAUAAGUGCUCUCUGUUAGGAUGAGCCCGACUGAGGAUCAAGACAUUGGUUUGC
Get precursor sequence
Structure
        10          20        30        40        50         
CAAGCAGUAAAGAACGA-  -|  CCUU  A         UCU          UGGAUAU 
                  CC CAG    GC CAUUCUAAC   GAGCACUUAU       G
                  GG GUC    CG GUAGGAUUG   CUCGUGAAUA       U
CGUUUGGUUACAGAACUA  A^  AGCC  A         UCU          CGAAGAA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Mature sequence

Sha-Mir-430-o9_5p

MirBase accessionNone
Sequence
0- AUUCUAACUCUGAGCACUUAUU -22
Get sequence
Co-mature sequence

Sha-Mir-430-o9_3p

MirBase accessionNone
Sequence
38- UAAGUGCUCUCUGUUAGGAUGA -60
Get sequence