MirGeneDB

MirGeneDB ID

Sha-Mir-219-P1

Family name MIR-219 (all species)
Seed GAUUGUC
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID
Paralogues Sha-Mir-219-P2 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(DEVIL7_traces)
GL856875.1: 214686-214746 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUAGUAACCAUCCUGCCGGGCAGCGGCUCCUGAUUGUCCAAACGCAAUUCUCGUGGCCGCGGCCCCCGAGAGUUGGGUCUGGACAUCCCGAGCCGCGGGCCCCCGNNNNNNNNNNCCCCAG
Get precursor sequence
Structure
        10          20         30        40        50          
CUAGUAACCAUCCUGCC--    A-|      CU   U     A  G         UGGCCG 
                   GGGC  GCGGCUC  GAU GUCCA AC CAAUUCUCG      \
                   CCCG  CGCCGAG  CUA CAGGU UG GUUGAGAGC      C
GACCCCNNNNNNNNNNGCC    GG^      CC   -     C  G         CCCCGG 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Mature sequence

Sha-Mir-219-P1_5p

MirBase accessionNone
Sequence
0- UGAUUGUCCAAACGCAAUUCUCG -23
Get sequence
Co-mature sequence

Sha-Mir-219-P1_3p

MirBase accessionNone
Sequence
38- AGAGUUGGGUCUGGACAUCCCGA -61
Get sequence