MirGeneDB

MirGeneDB ID

Sha-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID
Paralogues Sha-Mir-19-P1  Sha-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(DEVIL7_traces)
GL867596.1: 71025-71083 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b GL867596.1: 70445-70509 [-] UCSC Ensembl
Mir-92-P1b GL867596.1: 70582-70646 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUAGCAUUAAUCCCAGUGCUACUCACAGUCAGUUUUGCAGGUCUUGCAUCGGCCUGUGUCAAUUGCUGUGCAAAUCCAUGCAAAACUGAUUAUGAGGGCGUUCGCAUCUGCAUUUUCUG
Get precursor sequence
Structure
        10           20        30         40        50         
CUAGCAUUAAUCCCAGU---|  A    C             -  UC     U    CUGUG 
                    GCU CUCA AGUCAGUUUUGCA GG  UUGCA CGGC     \
                    CGG GAGU UUAGUCAAAACGU CC  AACGU GUCG     U
GUCUUUUACGUCUACGCUUG^  -    A             A  UA     -    UUAAC 
       110       100         90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Star sequence

Sha-Mir-19-P2b_5p*

MirBase accessionNone
Sequence
0- AGUUUUGCAGGUCUUGCAUCGGC -23
Get sequence
Mature sequence

Sha-Mir-19-P2b_3p

MirBase accessionNone
Sequence
36- UGUGCAAAUCCAUGCAAAACUGA -59
Get sequence