MirGeneDB

MirGeneDB ID

Rno-Mir-351-P1

Family name MIR-351 (all species)
Seed CCCUGAG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-351-1
Paralogues Rno-Mir-351-P2 
Orthologues Mmu-Mir-351 
Node of Origin (locus) R. norvegicus
Node of Origin (family) Muridae
Genome context
(rn6)
chrX: 158585602-158585661 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-351-P1)
Mir-15-P1d1 chrX: 158584564-158584621 [+] UCSC Ensembl
Mir-15-P2d1 chrX: 158584862-158584924 [+] UCSC Ensembl
Mir-351-P1 chrX: 158585602-158585661 [+] UCSC Ensembl
Mir-542-P1 chrX: 158588539-158588599 [+] UCSC Ensembl
Mir-450-P2a chrX: 158589644-158589700 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUGCCGUGACUAAUCAUGGCACCUCCAUUUCCCUGAGGAGCCCUUUGAGCCUGAGGUGAAAAAAAAACAGGUCAAGAGGCGCCUGGGAACUGGAGAAGAGUAUUAACUUCUGGAGCAAG
Get precursor sequence
Structure
        10        20         30        40        50        60 
UCUGCCGUGACUAAUCAUGGCAC-|    U     UG   A   C     G    AGGUGA 
                        CUCCA UUCCC  AGG GCC UUUGA CCUG      A
                        GAGGU AAGGG  UCC CGG GAACU GGAC      A
GAACGAGGUCUUCAAUUAUGAGAA^    C     --   G   A     -    AAAAAA 
.       110       100        90          80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-351-P1_5p

MirBase accessionMIMAT0000608
Sequence
0- UCCCUGAGGAGCCCUUUGAGCCUG -24
Get sequence
Star sequence

Rno-Mir-351-P1_3p*

MirBase accessionMIMAT0017041
Sequence
40- GGUCAAGAGGCGCCUGGGAA -60
Get sequence