MirGeneDB

MirGeneDB ID

Rno-Mir-33-P1

Family name MIR-33 (all species)
Seed UGCAUUG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-33
Paralogues
Orthologues Aae-Mir-33  Aca-Mir-33-P1  Ami-Mir-33-P1  Bge-Mir-33  Bta-Mir-33-P1  Cfa-Mir-33-P1  Cgi-Mir-33  Cin-Mir-33  Cli-Mir-33-P1  Cpi-Mir-33-P1  Cpo-Mir-33-P1  Cte-Mir-33  Dan-Mir-33  Dme-Mir-33  Dmo-Mir-33  Dno-Mir-33-P1  Dpu-Mir-33  Efe-Mir-33  Ete-Mir-33-P1  Gga-Mir-33-P1  Hsa-Mir-33-P1  Isc-Mir-33  Lgi-Mir-33  Mdo-Mir-33-P1  Mml-Mir-33-P1  Mmu-Mir-33-P1  Oan-Mir-33-P1  Ocu-Mir-33-P1  Pfl-Mir-33  Pmi-Mir-33  Sha-Mir-33-P1  Sko-Mir-33  Spu-Mir-33  Sto-Mir-33-P1  Tca-Mir-33  Tgu-Mir-33-P1  Xtr-Mir-33-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr7: 123431617-123431677 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGCCUCGUGCCUCCUGGCGGGCUGCCGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGCAGUACCUGUGCAAUGUUUCCACAGUGCAUCACGGAGGCCUGCCCUGGCUGCCCGCUGUGCU
Get precursor sequence
Structure
        10          20        30        40        50          
GGGCCUCGUGCCUCCUG--|      G              AGUU        UGUUCUGG 
                   GCGGGCU CCGUGGUGCAUUGU    GCAUUGCA        \
                   CGUCCGG GGCACUACGUGACA    UGUAACGU        C
UCGUGUCGCCCGUCGGUCC^      A              CCUU        GUCCAUGA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-33-P1_5p

MirBase accessionMIMAT0000812
Sequence
0- GUGCAUUGUAGUUGCAUUGCA -21
Get sequence
Validated targets microrna.org: MIMAT0000812
TargetScanVert: rno-miR-33-5p
miRDB: MIMAT0000812
Star sequence

Rno-Mir-33-P1_3p*

MirBase accessionMIMAT0017104
Sequence
40- CAAUGUUUCCACAGUGCAUCA -61
Get sequence
Validated targets TargetScanVert: rno-miR-33-3p
miRDB: MIMAT0017104