MirGeneDB

MirGeneDB ID

Rno-Mir-30-P1c

Family name MIR-30 (all species)
Seed GUAAACA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-30d
Paralogues Rno-Mir-30-P1a  Rno-Mir-30-P1b  Rno-Mir-30-P2a  Rno-Mir-30-P2b  Rno-Mir-30-P2c 
Orthologues Aca-Mir-30-P1c  Ami-Mir-30-P1c  Bta-Mir-30-P1c  Cfa-Mir-30-P1c  Cli-Mir-30-P1c  Cpi-Mir-30-P1c  Cpo-Mir-30-P1c  Dno-Mir-30-P1c  Dre-Mir-30-P1c  Ete-Mir-30-P1c  Gga-Mir-30-P1c  Hsa-Mir-30-P1c  Mdo-Mir-30-P1c  Mml-Mir-30-P1c  Mmu-Mir-30-P1c  Oan-Mir-30-P1c  Ocu-Mir-30-P1c  Sha-Mir-30-P1c  Sto-Mir-30-P1c  Tgu-Mir-30-P1c  Xtr-Mir-30-P1c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr7: 109286472-109286533 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUGUAGCUUGCUGUCAGAAAGUCUGUGUCUGUAAACAUCCCCGACUGGAAGCUGUAAGCCACAGCCAAGCUUUCAGUCAGAUGUUUGCUGCUACUGGCUCUUCGCAUGCAUCUUUUGGACA
Get precursor sequence
Structure
        10         20         30        40        50        60 
UUUGUAGCUUGCUGUCA-   -|   U   UCU         CCC           GUAAGC 
                  GAA AGUC GUG   GUAAACAUC   GACUGGAAGCU      C
                  CUU UCGG CAU   CGUUUGUAG   CUGACUUUCGA      A
ACAGGUUUUCUACGUACG   C^   U   CGU         A--           ACCGAC 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-30-P1c_5p

MirBase accessionMIMAT0000807
Sequence
0- UGUAAACAUCCCCGACUGGAAGCU -24
Get sequence
Validated targets microrna.org: MIMAT0000807
TargetScanVert: rno-miR-30d-5p
miRDB: MIMAT0000807
Star sequence

Rno-Mir-30-P1c_3p*

MirBase accessionMIMAT0004722
Sequence
40- CUUUCAGUCAGAUGUUUGCUGC -62
Get sequence
Validated targets microrna.org: MIMAT0004722
TargetScanVert: rno-miR-30d-3p
miRDB: MIMAT0004722