MirGeneDB

MirGeneDB ID

Rno-Mir-29-P2a

Family name MIR-29 (all species)
Seed AGCACCA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-29b-1
Paralogues Rno-Mir-29-P1a  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Rno-Mir-29-P2b3  Rno-Mir-29-P2b4 
Orthologues Aae-Mir-29-P2  Aca-Mir-29-P2a  Ami-Mir-29-P2a-v1  Ami-Mir-29-P2a-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Bta-Mir-29-P2a  Cbr-Mir-29-P2  Cel-Mir-29-P2  Cfa-Mir-29-P2a  Cgi-Mir-29-P2  Cli-Mir-29-P2a  Cpi-Mir-29-P2a  Cpo-Mir-29-P2a  Cte-Mir-29-P2  Dan-Mir-29-P2  Dme-Mir-29-P2  Dmo-Mir-29-P2  Dno-Mir-29-P2a  Dre-Mir-29-P2a  Ete-Mir-29-P2a  Gga-Mir-29-P2a  Hme-Mir-29-P2  Hsa-Mir-29-P2a  Mdo-Mir-29-P2a  Mml-Mir-29-P2a  Mmu-Mir-29-P2a  Oan-Mir-29-P2a  Ocu-Mir-29-P2a  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Sha-Mir-29-P2a  Sko-Mir-29-P2  Spu-Mir-29-P2  Sto-Mir-29-P2a  Tca-Mir-29-P2  Tgu-Mir-29-P2a  Xtr-Mir-29-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr4: 58344318-58344381 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P2a)
Mir-29-P1a chr4: 58343944-58344003 [-] UCSC Ensembl
Mir-29-P2a chr4: 58344318-58344381 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGACGAGAACAGACAAAGCUUCUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGUGGAGAACAACUUCGCUGCCGACCA
Get precursor sequence
Structure
        10          20        30         40        50        60  
GGACGAGAACAGACAAAG--    U       -|         U      GU     UUUAAAU 
                    CUUC UCAGGAA GCUGGUUUCA AUGGUG  UUAGA       \
                    GAGG GGUUCUU UGACUAAAGU UACCAC  GAUCU       A
ACCAGCCGUCGCUUCAACAA    U       G^         U      --     GUUAGUG 
  120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-29-P2a_5p*

MirBase accessionMIMAT0005445
Sequence
0- GCUGGUUUCAUAUGGUGGUUUAGA -24
Get sequence
Validated targets microrna.org: MIMAT0005445
TargetScanVert: rno-miR-29b-1-5p
miRDB: MIMAT0005445
Mature sequence

Rno-Mir-29-P2a_3p

MirBase accessionMIMAT0000801
Sequence
41- UAGCACCAUUUGAAAUCAGUGUU -64
Get sequence