MirGeneDB

MirGeneDB ID

Rno-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-23a
Paralogues Rno-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr19: 25318591-25318648 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P1)
Mir-23-P1 chr19: 25318591-25318648 [+] UCSC Ensembl
Mir-27-P1 chr19: 25318749-25318811 [+] UCSC Ensembl
Mir-24-P1 chr19: 25318887-25318944 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCUGUCCCCUCACUGUGCCUCGGCCGGCUGGGGUUCCUGGGGAUGGGAUUUGAUGCCAGUCACAAAUCACAUUGCCAGGGAUUUCCAACUGACCCUGUGCCCUGCCUUGGGGCCUCG
Get precursor sequence
Structure
        10        20         30         40        50        
UGCUGUCCCCUCACUGUGCCUC-  C   C   -|        G    G     GAUGC 
                       GG CGG UGG GGUUCCUGG GAUG GAUUU     C
                       CC GUC ACC UUAGGGACC UUAC CUAAA     A
GCUCCGGGGUUCCGUCCCGUGUC  A   A   U^        G    A     CACUG 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-23-P1_5p*

MirBase accessionMIMAT0004712
Sequence
0- GGGGUUCCUGGGGAUGGGAUUU -22
Get sequence
Validated targets microrna.org: MIMAT0004712
TargetScanVert: rno-miR-23a-5p
miRDB: MIMAT0004712
Mature sequence

Rno-Mir-23-P1_3p

MirBase accessionMIMAT0000792
Sequence
36- AUCACAUUGCCAGGGAUUUCCA -58
Get sequence
Validated targets microrna.org: MIMAT0000792
TargetScanVert: rno-miR-23a-3p
miRDB: MIMAT0000792