MirGeneDB

MirGeneDB ID

Rno-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr13: 112233301-112233358 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAGCCCCAGACAAUCCAUGGGUCCUCCUGUCCUUCAUUCCACCGGAGUCUGUCUUAUGCCAACCAGAUUUCAGUGGAGUGAAGCUCAGGAGGCAUGGAGCUGCCAGCGGUGGACUGA
Get precursor sequence
Structure
        10        20           30        40        50        
ACAGCCCCAGACAAUCCAUGG---|U       UC           C        UCUUA 
                        G CCUCCUG  CUUCAUUCCAC GGAGUCUG     U
                        C GGAGGAC  GAAGUGAGGUG CUUUAGAC     G
AGUCAGGUGGCGACCGUCGAGGUA^-       UC           A        CAACC 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-205-P1_5p

MirBase accessionMIMAT0000878
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Validated targets microrna.org: MIMAT0000878
TargetScanVert: rno-miR-205
miRDB: MIMAT0000878
Star sequence

Rno-Mir-205-P1_3p*

MirBase accessionNone
Sequence
36- GAUUUCAGUGGAGUGAAGCUCA -58
Get sequence