MirGeneDB

MirGeneDB ID

Rno-Mir-196-P3c

Family name MIR-196 (all species)
Seed AGGUAGU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-196b-1
Paralogues Rno-Mir-196-P1  Rno-Mir-196-P2  Rno-Mir-196-P3d 
Orthologues Aca-Mir-196-P3  Ami-Mir-196-P3  Bta-Mir-196-P3  Cfa-Mir-196-P3  Cin-Mir-196  Cli-Mir-196-P3  Cpi-Mir-196-P3  Cpo-Mir-196-P3  Dno-Mir-196-P3  Ete-Mir-196-P3  Hsa-Mir-196-P3  Mdo-Mir-196-P3  Mml-Mir-196-P3  Mmu-Mir-196-P3  Oan-Mir-196-P3  Ocu-Mir-196-P3  Sha-Mir-196-P3  Sto-Mir-196-P3  Tgu-Mir-196-P3  Xtr-Mir-196-P3 
Node of Origin (locus) R. norvegicus
Node of Origin (family) Olfactores
Genome context
(rn6)
chr4: 82284863-82284920 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCGAGGCAGCAUCUGAACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGAUCCACCUUUCUCUCGACAGCACGACACUGCCUUCAUUACUUCAGUUGAAAGCGUCUCCAGGUACC
Get precursor sequence
Structure
        10            20        30        40        50        
GCGAGGCAGCAUCUGAA----|   UC      UU       U  C           UCCA 
                     CUGG  GGUGAU  AGGUAGU UC UGUUGUUGGGA    C
                     GACU  UCAUUA  UCCGUCA AG ACGACAGCUCU    C
CCAUGGACCUCUGCGAAAGUU^   --      CU       C  C           CUUU 
      110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-196-P3c_5p

MirBase accessionMIMAT0001082
Sequence
0- UAGGUAGUUUCCUGUUGUUGGGA -23
Get sequence
Star sequence

Rno-Mir-196-P3c_3p*

MirBase accessionMIMAT0017171
Sequence
35- UCGACAGCACGACACUGCCUUCA -58
Get sequence