MirGeneDB

MirGeneDB ID

Rno-Mir-196-P2

Family name MIR-196 (all species)
Seed AGGUAGU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-196a
Paralogues Rno-Mir-196-P1  Rno-Mir-196-P3c  Rno-Mir-196-P3d 
Orthologues Aca-Mir-196-P2  Ami-Mir-196-P2  Bta-Mir-196-P2  Cfa-Mir-196-P2  Cin-Mir-196  Cli-Mir-196-P2  Cpi-Mir-196-P2  Cpo-Mir-196-P2  Dno-Mir-196-P2  Dre-Mir-196-P2a  Dre-Mir-196-P2b  Ete-Mir-196-P2  Gga-Mir-196-P2  Hsa-Mir-196-P2  Mml-Mir-196-P2  Mmu-Mir-196-P2  Oan-Mir-196-P2  Ocu-Mir-196-P2  Sha-Mir-196-P2  Tgu-Mir-196-P2  Xtr-Mir-196-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(rn6)
chr7: 144584259-144584317 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGGCCCUGUUUGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUCGGUUUUCGUCGAGGGCCCC
Get precursor sequence
Structure
        10            20        30        40        50         
CGGCCCUGUUUGCUCAG----|   UC                  A          AUUGAG 
                     CUGA  UGUGGCUUAGGUAGUUUC UGUUGUUGGG      \
                     GACU  ACAUUGAGUCCGUCAAAG ACAACGGCUC      U
CCCCGGGAGCUGCUUUUGGCU^   --                  A          AAGUUU 
       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-196-P2_5p

MirBase accessionMIMAT0000871
Sequence
0- UAGGUAGUUUCAUGUUGUUGGGA -23
Get sequence
Validated targets microrna.org: MIMAT0000871
TargetScanVert: rno-miR-196a-5p
miRDB: MIMAT0000871
Star sequence

Rno-Mir-196-P2_3p*

MirBase accessionMIMAT0004737
Sequence
36- UCGGCAACAAGAAACUGCCUGAG -59
Get sequence
Validated targets microrna.org: MIMAT0004737
TargetScanVert: rno-miR-196a-3p
miRDB: MIMAT0004737