MirGeneDB

MirGeneDB ID

Rno-Mir-190-P2

Family name MIR-190 (all species)
Seed GAUAUGU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-190b
Paralogues Rno-Mir-190-P1a  Rno-Mir-190-P1b 
Orthologues Aae-Mir-190  Aca-Mir-190-P2  Ami-Mir-190-P2  Asu-Mir-190  Bfl-Mir-190  Bge-Mir-190  Bta-Mir-190-P2  Cbr-Mir-190  Cel-Mir-190  Cfa-Mir-190-P2  Cgi-Mir-190  Cpi-Mir-190-P2  Cpo-Mir-190-P2  Cte-Mir-190  Dan-Mir-190  Dme-Mir-190  Dmo-Mir-190  Dno-Mir-190-P2  Dpu-Mir-190  Dre-Mir-190-P2  Ete-Mir-190-P2  Gga-Mir-190-P2  Hme-Mir-190  Hsa-Mir-190-P2  Isc-Mir-190  Mdo-Mir-190-P2  Mml-Mir-190-P2  Mmu-Mir-190-P2  Oan-Mir-190-P2  Ocu-Mir-190-P2  Pfl-Mir-190  Pmi-Mir-190  Sha-Mir-190-P2  Sko-Mir-190  Sto-Mir-190-P2  Tca-Mir-190  Tgu-Mir-190-P2  Xtr-Mir-190-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr2: 189421147-189421206 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UACACCAAAGUUUACCUGCCUGCUUCUGUGUGAUAUGUUUGAUAUUAGGUUGUUAAAUUAUGAACCAACUAAAUGUCAAACAUUCUCACAGCAGUGAGGAGACUUGGCACCACCUCCUCU
Get precursor sequence
Structure
        10           20         30        40        50         
UACACCAAAGUUUACCUG---   -|  U     U  U            A     UUAAAU 
                     CCU GCU CUGUG GA AUGUUUGAUAUU GGUUG      \
                     GGA UGA GACAC CU UACAAACUGUAA UCAAC      U
UCUCCUCCACCACGGUUCAGA   G^  C     U  -            A     CAAGUA 
.       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-190-P2_5p

MirBase accessionMIMAT0005302
Sequence
0- UGAUAUGUUUGAUAUUAGGUUG -22
Get sequence
Validated targets microrna.org: MIMAT0005302
TargetScanVert: rno-miR-190b-5p
miRDB: MIMAT0005302
Star sequence

Rno-Mir-190-P2_3p*

MirBase accessionMIMAT0017298
Sequence
37- ACUAAAUGUCAAACAUUCUCACA -60
Get sequence
Validated targets TargetScanVert: rno-miR-190b-3p
miRDB: MIMAT0017298