MirGeneDB

MirGeneDB ID

Rno-Mir-190-P1a

Family name MIR-190 (all species)
Seed GAUAUGU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-190a-1
Paralogues Rno-Mir-190-P1b  Rno-Mir-190-P2 
Orthologues Aae-Mir-190  Aca-Mir-190-P1  Ami-Mir-190-P1  Asu-Mir-190  Bfl-Mir-190  Bge-Mir-190  Bta-Mir-190-P1  Cbr-Mir-190  Cel-Mir-190  Cfa-Mir-190-P1  Cgi-Mir-190  Cli-Mir-190-P1  Cpi-Mir-190-P1  Cpo-Mir-190-P1  Cte-Mir-190  Dan-Mir-190  Dme-Mir-190  Dmo-Mir-190  Dno-Mir-190-P1  Dpu-Mir-190  Dre-Mir-190-P1  Ete-Mir-190-P1  Gga-Mir-190-P1  Hme-Mir-190  Hsa-Mir-190-P1  Isc-Mir-190  Mdo-Mir-190-P1  Mml-Mir-190-P1  Mmu-Mir-190-P1  Oan-Mir-190-P1  Ocu-Mir-190-P1  Pfl-Mir-190  Pmi-Mir-190  Sha-Mir-190-P1  Sko-Mir-190  Sto-Mir-190-P1  Tca-Mir-190  Tgu-Mir-190-P1 
Node of Origin (locus) R. norvegicus
Node of Origin (family) Bilateria
Genome context
(rn6)
chr8: 80928179-80928236 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCUGGAUGCCUUUUCUGCAGGCCUCUGUGUGAUAUGUUUGAUAUAUUAGGUUGUUAUUUAAUCCAACUAUAUAUCAAGCAUAUUCCUACAGUGUCUUGCCCUGUCUCCGGGGGUCCU
Get precursor sequence
Structure
        10         20        30         40        50         
ACCUGGAUGCCUUUUCU-     CCU     U-|               UA     UUAU 
                  GCAGG   CUGUG  GAUAUGUUUGAUAUAU  GGUUG    U
                  CGUUC   GACAU  UUAUACGAACUAUAUA  UCAAC    U
UCCUGGGGGCCUCUGUCC     UGU     CC^               --     CUAA 
      110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-190-P1a_5p

MirBase accessionMIMAT0000865
Sequence
0- UGAUAUGUUUGAUAUAUUAGGUUG -24
Get sequence
Star sequence

Rno-Mir-190-P1a_3p*

MirBase accessionMIMAT0017145
Sequence
36- ACUAUAUAUCAAGCAUAUUCCU -58
Get sequence