MirGeneDB

MirGeneDB ID

Rno-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-19b-2
Paralogues Rno-Mir-19-P1  Rno-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chrX: 140117391-140117456 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b chrX: 140117108-140117172 [-] UCSC Ensembl
Mir-92-P1b chrX: 140117265-140117325 [-] UCSC Ensembl
Mir-19-P2b chrX: 140117391-140117456 [-] UCSC Ensembl
Mir-17-P3b chrX: 140117522-140117582 [-] UCSC Ensembl
Mir-17-P1b chrX: 140117900-140117958 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UACUGUGCGAGGACAUUGCUACUUACGGUUAGUUUUGCAGAUUUGCAGUUCAGCGUAUAUGUGGAUAUAUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAUGAUGUGUGCCUUUCUGCAUCUUU
Get precursor sequence
Structure
        10        20          30          40        50        60   
UACUGUGCGAGGACAUUGCUAC--                 --|       GUU    GUAUAUGU 
                        UUACGGUUAGUUUUGCA  GAUUUGCA   CAGC        \
                        AGUGUUAGUCAAAACGU  CUAAACGU   GUCG        G
UUUCUACGUCUUUCCGUGUGUAGU                 AC^       ---    GUAUAUAG 
    120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-19-P2b_5p* (predicted)

MirBase accessionMIMAT0017097
Sequence
0- AGUUUUGCAGAUUUGCAGUUCAGC -24
Get sequence
Validated targets TargetScanVert: rno-miR-19b-2-5p
miRDB: MIMAT0017097
Mature sequence

Rno-Mir-19-P2b_3p

MirBase accessionMIMAT0000788
Sequence
43- UGUGCAAAUCCAUGCAAAACUGA -66
Get sequence
Validated targets microrna.org: MIMAT0000788
TargetScanVert: rno-miR-19b-3p
miRDB: MIMAT0000788