MirGeneDB

MirGeneDB ID

Rno-Mir-15-P1d1

Family name MIR-15 (all species)
Seed AGCAGCA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-322-1
Paralogues Rno-Mir-15-P1a  Rno-Mir-15-P1b  Rno-Mir-15-P1c  Rno-Mir-15-P1d2  Rno-Mir-15-P2a  Rno-Mir-15-P2b  Rno-Mir-15-P2c  Rno-Mir-15-P2d1  Rno-Mir-15-P2d2 
Orthologues Aca-Mir-15-P1d  Ami-Mir-15-P1d  Bta-Mir-15-P1d  Cfa-Mir-15-P1d  Cin-Mir-15-P1  Cli-Mir-15-P1d  Cpi-Mir-15-P1d  Cpo-Mir-15-P1d  Dno-Mir-15-P1d  Ete-Mir-15-P1d  Gga-Mir-15-P1d  Hsa-Mir-15-P1d  Mdo-Mir-15-P1d-v1  Mdo-Mir-15-P1d-v2  Mml-Mir-15-P1d  Mmu-Mir-15-P1d-v1  Mmu-Mir-15-P1d-v2  Mmu-Mir-15-P1d-v3  Oan-Mir-15-P1d  Ocu-Mir-15-P1d  Sha-Mir-15-P1d  Tgu-Mir-15-P1d  Xtr-Mir-15-P1d 
Node of Origin (locus) R. norvegicus
Node of Origin (family) Olfactores
Genome context
(rn6)
chrX: 158584564-158584621 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P1d1)
Mir-15-P1d1 chrX: 158584564-158584621 [+] UCSC Ensembl
Mir-15-P2d1 chrX: 158584862-158584924 [+] UCSC Ensembl
Mir-351-P1 chrX: 158585602-158585661 [+] UCSC Ensembl
Mir-542-P1 chrX: 158588539-158588599 [+] UCSC Ensembl
Mir-450-P2a chrX: 158589644-158589700 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCCCCACCCUCGCUGACUCCGAAGGGAUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGAAAUAGAGAGGUGGGGUC
Get precursor sequence
Structure
        10         20         30        40        50        
GCCCCCACCCUCGCUGA-   -|      A  CA     AA             GUAUU 
                  CUC CGAAGGG UG  GCAGC  UUCAUGUUUUGGA     G
                  GGG GCUUCCC AC  CGUCG  AAGUACAAAACUU     C
CUGGGGUGGAGAGAUAAA   U^      C  AA     CG             GGAAC 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-15-P1d1_5p

MirBase accessionMIMAT0001619
Sequence
0- CAGCAGCAAUUCAUGUUUUGGA -22
Get sequence
Star sequence

Rno-Mir-15-P1d1_3p*

MirBase accessionMIMAT0000547
Sequence
36- CAAAACAUGAAGCGCUGCAACA -58
Get sequence