MirGeneDB

MirGeneDB ID

Rno-Mir-146-P2

Family name MIR-146 (all species)
Seed GAGAACU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-146b
Paralogues Rno-Mir-146-P1 
Orthologues Aca-Mir-146-P2  Ami-Mir-146-P2  Bta-Mir-146-P2  Cfa-Mir-146-P2  Cli-Mir-146-P2  Cpi-Mir-146-P2  Cpo-Mir-146-P2  Dno-Mir-146-P2  Dre-Mir-146-P2  Ete-Mir-146-P2  Gga-Mir-146-P2  Hsa-Mir-146-P2  Mdo-Mir-146-P2  Mml-Mir-146-P2  Mmu-Mir-146-P2  Oan-Mir-146-P2  Ocu-Mir-146-P2  Sha-Mir-146-P2  Tgu-Mir-146-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr1: 266089502-266089561 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGGCUGAGAGAACUUUGGCCACCUGGCCCUGAGAACUGAAUUCCAUAGGCUGUGAACUCUAGCAGAUGCCCUAGGGACUCAGUUCUGGUGCCUGGCUGUGCUACACCAUCGAUACCAAC
Get precursor sequence
Structure
        10             20         30        40        50          
CAGGCUGAGAGAACUUU-----|    CCU   -  UG        A    AUA   UGUGAACU 
                      GGCCA   GGC CC  AGAACUGA UUCC   GGC        \
                      UCGGU   CCG GG  UCUUGACU AGGG   CCG        C
CAACCAUAGCUACCACAUCGUG^    ---   U  --        C    AUC   UAGACGAU 
.       110       100           90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-146-P2_5p

MirBase accessionMIMAT0005595
Sequence
0- UGAGAACUGAAUUCCAUAGGCUGU -24
Get sequence
Validated targets microrna.org: MIMAT0005595
TargetScanVert: rno-miR-146b-5p
miRDB: MIMAT0005595
Star sequence

Rno-Mir-146-P2_3p*

MirBase accessionMIMAT0017334
Sequence
38- GCCCUAGGGACUCAGUUCUGGU -60
Get sequence
Validated targets TargetScanVert: rno-miR-146b-3p
miRDB: MIMAT0017334