MirGeneDB

MirGeneDB ID

Rno-Mir-140-v1

Family name MIR-140 (all species)
Seed CCACAGG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-140
Paralogues Rno-Mir-140-v2 
Orthologues Aca-Mir-140-v1  Ami-Mir-140-v1  Bta-Mir-140-v1  Cfa-Mir-140-v1  Cli-Mir-140-v1  Cpi-Mir-140-v1  Cpo-Mir-140-v1  Dno-Mir-140-v1  Dre-Mir-140-v1  Ete-Mir-140-v1  Gga-Mir-140-v1  Hsa-Mir-140-v1  Mdo-Mir-140-v1  Mml-Mir-140-v1  Mmu-Mir-140-v1  Oan-Mir-140-v1  Ocu-Mir-140-v1  Sha-Mir-140-v1  Sto-Mir-140-v1  Tgu-Mir-140-v1  Xtr-Mir-140-v1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr19: 39608972-39609033 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-140-v1)
Mir-140-v1 chr19: 39608972-39609033 [+] UCSC Ensembl
Mir-140-v2 chr19: 39608972-39609033 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCGCCCUGUGUGUCUCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACAUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGGAUACUGGAGCACCCUCUGCAUCGAAGG
Get precursor sequence
Structure
        10         20          30        40        50        60
CCGCCCUGUGUGUCUCU-    -        -| A             A      GUUACAU 
                  CUCU GUGUCCUG CC GUGGUUUUACCCU UGGUAG       C
                  GAGG CAUAGGAC GG CACCAAGAUGGGA ACCAUC       A
GGAAGCUACGUCUCCCAC    U        A^ -             C      UUGUCGU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-140-v1_5p*

MirBase accessionMIMAT0000573
Sequence
0- CAGUGGUUUUACCCUAUGGUAG -22
Get sequence
Validated targets microrna.org: MIMAT0000573
TargetScanVert: rno-miR-140-5p
miRDB: MIMAT0000573
Mature sequence

Rno-Mir-140-v1_3p

MirBase accessionMIMAT0000574
Sequence
40- ACCACAGGGUAGAACCACGGAC -62
Get sequence
Validated targets microrna.org: MIMAT0000574
TargetScanVert: rno-miR-140-3p
miRDB: MIMAT0000574