MirGeneDB

MirGeneDB ID

Rno-Mir-130-P1b

Family name MIR-130 (all species)
Seed AGUGCAA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-130b
Paralogues Rno-Mir-130-P1a  Rno-Mir-130-P2a  Rno-Mir-130-P2b 
Orthologues Aca-Mir-130-P1b  Bta-Mir-130-P1b  Cfa-Mir-130-P1b  Cpi-Mir-130-P1b  Cpo-Mir-130-P1b  Dno-Mir-130-P1b  Dre-Mir-130-P1b1  Ete-Mir-130-P1b  Gga-Mir-130-P1b  Hsa-Mir-130-P1b  Mdo-Mir-130-P1b  Mml-Mir-130-P1b  Mmu-Mir-130-P1b  Ocu-Mir-130-P1b  Sha-Mir-130-P1b  Sto-Mir-130-P1b  Tgu-Mir-130-P1b  Xtr-Mir-130-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr11: 88129785-88129844 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P1b)
Mir-130-P2b chr11: 88129435-88129492 [+] UCSC Ensembl
Mir-130-P1b chr11: 88129785-88129844 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UACCCCUUGAGACUGACUGGCUUGCUGGACACUCUUUCCCUGUUGCACUACUGUGGGCCUCUGGGAAGCAGUGCAAUGAUGAAAGGGCAUCCGUCAGGCCAGCUAAGGAACCUGAAGUAC
Get precursor sequence
Structure
        10          20        30        40        50         
UACCCCUUGAGACUGAC--|      C    CA       CC         A  GUGGGC 
                   UGGCUUG UGGA  CUCUUUC  UGUUGCACU CU      C
                   ACCGGAC GCCU  GGGAAAG  GUAACGUGA GA      U
CAUGAAGUCCAAGGAAUCG^      U    AC       UA         C  AGGGUC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUGUG in loop
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-130-P1b_5p*

MirBase accessionMIMAT0017122
Sequence
0- ACUCUUUCCCUGUUGCACUACU -22
Get sequence
Validated targets TargetScanVert: rno-miR-130b-5p
miRDB: MIMAT0017122
Mature sequence

Rno-Mir-130-P1b_3p

MirBase accessionMIMAT0000837
Sequence
38- CAGUGCAAUGAUGAAAGGGCAU -60
Get sequence
Validated targets microrna.org: MIMAT0000837
TargetScanVert: rno-miR-130b-3p
miRDB: MIMAT0000837