MirGeneDB

MirGeneDB ID

Rno-Mir-126-v1

Family name MIR-126 (all species)
Seed AUUAUUA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-126a
Paralogues Rno-Mir-126-v2  Rno-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(rn6)
chr3: 4042496-4042554 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v1 chr3: 4042496-4042554 [+] UCSC Ensembl
Mir-126-v2 chr3: 4042496-4042554 [+] UCSC Ensembl
Mir-126-v3 chr3: 4042496-4042554 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUGGAGCCGUGUCUUUGCCGGUGACAGCACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGUGAGUAAUAAUGCGUGGUCAACAGCGCAGCACCGGGAGUGCAUC
Get precursor sequence
Structure
        10          20        30        40        50         
CCUGGAGCCGUGUCUUU--| CGG    A  A           U       CGCUGUGAC 
                   GC   UGAC GC CAUUAUUACUU UGGUACG         \
                   CG   ACUG UG GUAAUAAUGAG GCCAUGC         A
CUACGUGAGGGCCACGACG^ ACA    G  C           U       UCAAACUUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-126-v1_5p

MirBase accessionMIMAT0000831
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Validated targets microrna.org: MIMAT0000831
TargetScanVert: rno-miR-126a-5p
miRDB: MIMAT0000831
Star sequence

Rno-Mir-126-v1_3p*

MirBase accessionMIMAT0000832
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence
Validated targets microrna.org: MIMAT0000832
TargetScanVert: rno-miR-126a-3p
miRDB: MIMAT0000832