MirGeneDB

MirGeneDB ID

Ocu-Mir-24-P1

Family name MIR-24 (all species)
Seed GGCUCAG
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-24-2
Paralogues Ocu-Mir-24-P2 
Orthologues Aca-Mir-24-P1  Ami-Mir-24-P1  Bta-Mir-24-P1  Cfa-Mir-24-P1  Cpi-Mir-24-P1  Cpo-Mir-24-P1  Dno-Mir-24-P1  Dre-Mir-24-P1  Ete-Mir-24-P1  Hsa-Mir-24-P1  Mdo-Mir-24-P1  Mml-Mir-24-P1  Mmu-Mir-24-P1  Oan-Mir-24-P1  Rno-Mir-24-P1  Sha-Mir-24-P1  Sto-Mir-24-o1  Sto-Mir-24-P1  Xtr-Mir-24-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(oryCun2)
chrUn0990: 23718-23778 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCGCCCGGCCGCCCUGGGCUCCGCCUCCCGUACCUACUGAGCUGAAACACAGUUGAUGUCGUGGACACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCGCUUGGACGCUGGCGGCCG
Get precursor sequence
Structure
        10           20        30        40        50        60 
GCCGCCCGGCCGCCCUG---|    C C    C  A   A         AACA    UGAUGU 
                    GGCUC G CUCC GU CCU CUGAGCUGA    CAGU      \
                    CCGAG C GAGG CA GGA GACUUGACU    GUCA      C
GCCGGCGGUCGCAGGUUCGC^    - U    A  A   C         CG--    CAGGUG 
 .       110       100         90        80          70
Deep sequencing
Go to detailed chart
CommentAlthough not well supported by deep read data all taxa sequenced in this study show the same read pattern and better more deeply sequenced vertebrate taxa are all clearly Group 2 miRNAs suggesting that this too is likely a Group 2 miRNA.
3' NTU Yes
MotifsNo
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-24-P1_5p*

MirBase accessionMIMAT0048132
Sequence
0- GUACCUACUGAGCUGAAACACAGU -24
Get sequence
Mature sequence

Ocu-Mir-24-P1_3p

MirBase accessionMIMAT0048131
Sequence
39- UGGCUCAGUUCAGCAGGAACAG -61
Get sequence