MirGeneDB

MirGeneDB ID

Ocu-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(oryCun2)
chr16: 63274211-63274269 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGCCCUCGACCAUCCAUGCGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGGCGACGACCACAGUG
Get precursor sequence
Structure
        10        20            30        40        50         
CAGCCCUCGACCAUCCAUGC----| UU      UC           C        UCUCAU 
                        GC  CUCUUG  CUUCAUUCCAC GGAGUCUG      \
                        CG  GAGGAC  GAAGUGAGGUG CUUUAGAC      A
GUGACACCAGCAGCGGUCGAGGUA^ --      UU           A        CAACCC 
       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
He Ki Te To Wh
Mature sequence

Ocu-Mir-205-P1_5p

MirBase accessionMIMAT0048325
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Star sequence

Ocu-Mir-205-P1_3p*

MirBase accessionMIMAT0048326
Sequence
37- GAUUUCAGUGGAGUGAAGUUCA -59
Get sequence