MirGeneDB

MirGeneDB ID

Ocu-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-19b-2
Paralogues Ocu-Mir-19-P1  Ocu-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(oryCun2)
chrX: 108518503-108518568 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b chrX: 108518210-108518274 [-] UCSC Ensembl
Mir-92-P1b chrX: 108518367-108518428 [-] UCSC Ensembl
Mir-19-P2b chrX: 108518503-108518568 [-] UCSC Ensembl
Mir-17-P3b chrX: 108518632-108518692 [-] UCSC Ensembl
Mir-17-P2b chrX: 108518869-108518933 [-] UCSC Ensembl
Mir-17-P1b chrX: 108519035-108519093 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGAUGUUCAGAAUCAAUGCUACUCACAAUUAGUUUUGCAGGUUUGCAUUUCAGCGUAUACCUGUAUACAUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAUCACGUGUGCUUUCUACAUUUUGU
Get precursor sequence
Structure
        10        20          30         40         50        60   
GGAUGUUCAGAAUCAAUGCUAC--                 -  -|     UUU    GUAUACCU 
                        UCACAAUUAGUUUUGCA GG UUUGCA   CAGC        \
                        AGUGUUAGUCAAAACGU CC AAACGU   GUCG        G
UGUUUUACAUCUUUCGUGUGCACU                 A  U^     ---    GUACAUAU 
    120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-19-P2b_5p* (predicted)

MirBase accessionMIMAT0048119
Sequence
0- AGUUUUGCAGGUUUGCAUUUCAGC -24
Get sequence
Mature sequence

Ocu-Mir-19-P2b_3p

MirBase accessionMIMAT0048118
Sequence
43- UGUGCAAAUCCAUGCAAAACUGA -66
Get sequence