MirGeneDB

MirGeneDB ID

Oan-Mir-9-P3

Family name MIR-9 (all species)
Seed CUUUGGU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID
Paralogues Oan-Mir-9-P1-v1  Oan-Mir-9-P1-v2  Oan-Mir-9-P2  Oan-Mir-9-P4 
Orthologues Aca-Mir-9-P3  Ami-Mir-9-P3  Bta-Mir-9-P3  Cfa-Mir-9-P3  Cin-Mir-9  Cpi-Mir-9-P3  Cpo-Mir-9-P3  Cte-Mir-9  Dno-Mir-9-P3  Dre-Mir-9-P3a  Dre-Mir-9-P3b  Ete-Mir-9-P3  Gga-Mir-9-P3  Hsa-Mir-9-P3  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P3  Mml-Mir-9-P3  Mmu-Mir-9-P3  Ocu-Mir-9-P3  Pmi-Mir-9  Rno-Mir-9-P3  Sha-Mir-9-P3  Spu-Mir-9  Sto-Mir-9-P3  Tgu-Mir-9-P3  Xtr-Mir-9-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041732.1: 21919514-21919575 [+]
Precursor
(pre-Mir +30nt flank)
UCCCCCGCGCCGGACCGAGGCCCGUUUCUCUCUUUGGUUAUCUAGCUGUAUGAGUGUAAUUGAGCCAUCAUAAAGCUAGAUAACCGAAAGUAGAAAUGACUUUCACAACUUCUCAGAGCGAG
Get precursor sequence
Structure
        10        20           30        40        50        60
UCCCCCGCGCCGGACCGAGGCC--       -| C               G     GUGUAA 
                        CGUUUCU CU UUUGGUUAUCUAGCU UAUGA      U
                        GUAAAGA GA AAGCCAAUAGAUCGA AUACU      U
GAGCGAGACUCUUCAACACUUUCA       U^ -               A     ACCGAG 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Ce He Ki Te
Mature sequence

Oan-Mir-9-P3_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Oan-Mir-9-P3_3p*

MirBase accessionNone
Sequence
39- AUAAAGCUAGAUAACCGAAAGUA -62
Get sequence