MirGeneDB

MirGeneDB ID

Oan-Mir-9-P1-v2

Family name MIR-9 (all species)
Seed CUUUGGU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID
Paralogues Oan-Mir-9-P1-v1  Oan-Mir-9-P2  Oan-Mir-9-P3  Oan-Mir-9-P4 
Orthologues Ami-Mir-9-P1  Bta-Mir-9-P1  Cfa-Mir-9-P1  Cin-Mir-9  Cli-Mir-9-P1  Cpi-Mir-9-P1  Cpo-Mir-9-P1  Cte-Mir-9  Dno-Mir-9-P1  Dre-Mir-9-P1  Ete-Mir-9-P1  Gga-Mir-9-P1  Hsa-Mir-9-P1  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P1  Mml-Mir-9-P1  Mmu-Mir-9-P1  Ocu-Mir-9-P1  Pmi-Mir-9  Rno-Mir-9-P1  Sha-Mir-9-P1  Spu-Mir-9  Xtr-Mir-9-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041753.1: 164722-164782 [-]
Precursor
(pre-Mir +30nt flank)
CGGCGCGCCCGUGUCCGGGGUUGGUUGUUGUCUUUGGUUACCCAGCUGUAUGAGCGAGGUGCGAUCCCAUAAAGCUGGCUAACCGAAAGGAAAAACAGCCCGAGUUCACGCCACCGACGCC
Get precursor sequence
Structure
        10           20        30         40        50          
CGGCGCGCCCGUGUCCG---|     GUUG  GU    -     C      G    AGCGAGG 
                    GGGUUG    UU  CUUU GGUUA CCAGCU UAUG       \
                    CCCGAC    AA  GAAA CCAAU GGUCGA AUAC       U
CCGCAGCCACCGCACUUGAG^     AA--  AG    G     C      A    CCUAGCG 
 .       110       100          90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Mature sequence

Oan-Mir-9-P1-v2_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUACCCAGCUGUAUGA -23
Get sequence
Star sequence

Oan-Mir-9-P1-v2_3p*

MirBase accessionNone
Sequence
38- AUAAAGCUGGCUAACCGAAAGGA -61
Get sequence