MirGeneDB

MirGeneDB ID

Oan-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-23a
Paralogues Oan-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mOrnAna1.p.v1_plustraces)
Oan-Mir-23-P1_KAAE-bpy46e04: 256-315 [-]
Precursor
(pre-Mir +30nt flank)
UCUACCCGAGCCCCUCUGCCGCCGGCGGCUGGGGUUCCUGGUGAUGCGAUUUUCUUGUGCUCGCCAAAAUCACAUUGCCAGGGAUUUCCAACUGGCGGCGUGCCCAGCUGGCAGGAGUGC
Get precursor sequence
Structure
        10            20        30        40        50         
UCUACCCGAGCCCCUCU----|       CGGCU GG        UG   C     UCUUGU 
                     GCCGCCGG     G  GUUCCUGG  AUG GAUUU      G
                     CGGCGGUC     C  UAGGGACC  UAC CUAAA      C
CGUGAGGACGGUCGACCCGUG^       AAC-- UU        GU   A     ACCGCU 
.       110       100        90          80        70        60
Deep sequencing
Go to detailed chart
CommentNot in assenbmly but in trace archives.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Oan-Mir-23-P1_5p*

MirBase accessionMIMAT0007060
Sequence
0- GGGGUUCCUGGUGAUGCGAUUU -22
Get sequence
Mature sequence

Oan-Mir-23-P1_3p

MirBase accessionMIMAT0007061
Sequence
38- AUCACAUUGCCAGGGAUUUCCA -60
Get sequence