MirGeneDB

MirGeneDB ID

Oan-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041734.1: 65176531-65176589 [+]
Precursor
(pre-Mir +30nt flank)
GAAUUCGGAACGAUCCAUGGGUUUCUGUUGUCCUUCAUUCCACCGGAGUCUGUUUCGUACCUAAUCAGAUUUCAGUGGAGUGAAGCACAAGAGGCAUGGAGUUGAAUCUACCGCCACGA
Get precursor sequence
Structure
        10        20            30        40        50         
GAAUUCGGAACGAUCCAUGG----|     GU   C           C        UUUCGU 
                        GUUUCU  UGU CUUCAUUCCAC GGAGUCUG      \
                        CGGAGA  ACA GAAGUGAGGUG CUUUAGAC      A
AGCACCGCCAUCUAAGUUGAGGUA^     --   C           A        UAAUCC 
       110       100        90          80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
Br Ce He Ki Te
Mature sequence

Oan-Mir-205-P1_5p

MirBase accessionMIMAT0006866
Sequence
0- UCCUUCAUUCCACCGGAGUCUGU -23
Get sequence
Star sequence

Oan-Mir-205-P1_3p* (predicted)

MirBase accessionMIMAT0006867
Sequence
36- AGAUUUCAGUGGAGUGAAGCACA -59
Get sequence