MirGeneDB

MirGeneDB ID

Oan-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-19b-1
Paralogues Oan-Mir-19-P1  Oan-Mir-19-P2a1  Oan-Mir-19-P2a2 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041733.1: 24649885-24649944 [-]
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b NC_041733.1: 24649599-24649663 [-]
Mir-92-P1b NC_041733.1: 24649741-24649802 [-]
Mir-19-P2b NC_041733.1: 24649885-24649944 [-]
Mir-17-P3b NC_041733.1: 24650009-24650072 [-]
Mir-17-P2b NC_041733.1: 24650219-24650283 [-]
Mir-17-P1b NC_041733.1: 24650384-24650441 [-]
Precursor
(pre-Mir +30nt flank)
GGAAUUGGAAAGACAGUACUGCUUACAGUCAGUUUUGCAGGUUUGCAUCCCAGCGUAUACAAAUUGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAUGGUGUUUGCUAUCUUGCUAAGUA
Get precursor sequence
Structure
        10           20        30         40         50          
GGAAUUGGAAAGACAGU---    C                 -  -|     UCC    GUAUA 
                    ACUG UUACAGUCAGUUUUGCA GG UUUGCA   CAGC     \
                    UGGU AGUGUUAGUCAAAACGU CC AAACGU   GUCG     C
AUGAAUCGUUCUAUCGUUUG    -                 A  U^     ---    UUAAA 
.       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Oan-Mir-19-P2b_5p*

MirBase accessionMIMAT0006855
Sequence
0- AGUUUUGCAGGUUUGCAUCCCAGC -24
Get sequence
Mature sequence

Oan-Mir-19-P2b_3p

MirBase accessionMIMAT0006856
Sequence
37- UGUGCAAAUCCAUGCAAAACUGA -60
Get sequence