MirGeneDB

MirGeneDB ID

Oan-Mir-142-v2

Family name MIR-142 (all species)
Seed UAGUGUU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-142
Paralogues Oan-Mir-142-v1  Oan-Mir-142-v3  Oan-Mir-142-v4 
Orthologues Bta-Mir-142-v2  Cfa-Mir-142-v2  Cpo-Mir-142-v2  Dno-Mir-142-v2  Ete-Mir-142-v2  Hsa-Mir-142-v2  Mdo-Mir-142-v2  Mml-Mir-142-v2  Mmu-Mir-142-v2  Ocu-Mir-142-v2  Rno-Mir-142-v2  Sha-Mir-142-v2  Sto-Mir-142-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041744.1: 11231636-11231694 [-]
Clustered MiRNAs
(< 10kb from Mir-142-v2)
Mir-142-v4 NC_041744.1: 11231634-11231696 [-]
Mir-142-v1 NC_041744.1: 11231636-11231694 [-]
Mir-142-v2 NC_041744.1: 11231636-11231694 [-]
Mir-142-v3 NC_041744.1: 11231636-11231694 [-]
Precursor
(pre-Mir +30nt flank)
CACGACAGACAGACAGACAGUGCAGUCAUCCAUAAAGUAGAAAGCACUACUAACAGCGCUGUAGGGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUGGGCUUCGGAGAACUCUC
Get precursor sequence
Structure
        10          20        30        40        50         
CACGACAGACAGACAGA--|      G               A         UAACAGCG 
                   CAGUGCA UCAUCCAUAAAGUAG AAGCACUAC        \
                   GUCAUGU AGUAGGUAUUUCAUC UUUGUGAUG        C
CUCUCAAGAGGCUUCGGGU^      G               C         UGGGAUGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Oan-Mir-142-v2_5p*

MirBase accessionMIMAT0006982
Sequence
0- CAUAAAGUAGAAAGCACUACUA -22
Get sequence
Mature sequence

Oan-Mir-142-v2_3p

MirBase accessionMIMAT0006983
Sequence
37- GUAGUGUUUCCUACUUUAUGGA -59
Get sequence