MirGeneDB

MirGeneDB ID

Mmu-Mir-7-P3

Family name MIR-7 (all species)
Seed GGAAGAC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-7b
Paralogues Mmu-Mir-7-P1  Mmu-Mir-7-P2 
Orthologues Aae-Mir-7  Aca-Mir-7-P3  Ami-Mir-7-P3  Asu-Mir-7  Bfl-Mir-7  Bge-Mir-7  Bta-Mir-7-P3  Cfa-Mir-7-P3  Cgi-Mir-7  Cin-Mir-7  Cli-Mir-7-P3  Cpi-Mir-7-P3  Cpo-Mir-7-P3  Cte-Mir-7  Dan-Mir-7  Dme-Mir-7  Dmo-Mir-7  Dno-Mir-7-P3  Ete-Mir-7-P3  Gga-Mir-7-P3  Hme-Mir-7  Hsa-Mir-7-P3  Isc-Mir-7  Lan-Mir-7  Lgi-Mir-7  Mdo-Mir-7-P3  Mml-Mir-7-P3  Ocu-Mir-7-P3  Pfl-Mir-7  Pmi-Mir-7  Rno-Mir-7-P3  Sha-Mir-7-P3  Sko-Mir-7  Spu-Mir-7  Sto-Mir-7-P3  Tgu-Mir-7-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr17: 56243017-56243076 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGGAGCGGAGUACGUGAGCCAGUGCUAUGUGGAAGACUUGUGAUUUUGUUGUUCUGAUAUGAUAUGACAACAAGUCACAGCCAGCCUCAUAGCGUGGACUCCUAUCACCUUUCUCCUGA
Get precursor sequence
Structure
        10           20        30        40        50        60
GAGGAGCGGAGUACGUG--  -|  G       U  AAGAC         U      CUGAU 
                   AG CCA UGCUAUG GG     UUGUGAUUU GUUGUU     A
                   UC GGU GCGAUAC CC     GACACUGAA CAACAG     U
AGUCCUCUUUCCACUAUCC  A^  -       U  GACC-         -      UAUAG 
.       110       100         90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-7-P3_5p

MirBase accessionMIMAT0000678
Sequence
0- UGGAAGACUUGUGAUUUUGUUGUU -24
Get sequence
Validated targets microrna.org: MIMAT0000678
TargetScanVert: mmu-miR-7b-5p
miRDB: MIMAT0000678
Star sequence

Mmu-Mir-7-P3_3p*

MirBase accessionMIMAT0017071
Sequence
38- CAACAAGUCACAGCCAGCCUCA -60
Get sequence
Validated targets TargetScanVert: mmu-miR-7b-3p
miRDB: MIMAT0017071