MirGeneDB

MirGeneDB ID

Mmu-Mir-455

Family name MIR-455 (all species)
Seed AUGUGCC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-455
Paralogues
Orthologues Aca-Mir-455  Ami-Mir-455  Bta-Mir-455  Cfa-Mir-455  Cli-Mir-455  Cpi-Mir-455  Cpo-Mir-455  Dno-Mir-455  Dre-Mir-455-P1  Dre-Mir-455-P2  Ete-Mir-455  Gga-Mir-455  Hsa-Mir-455  Mdo-Mir-455  Mml-Mir-455  Oan-Mir-455  Ocu-Mir-455  Rno-Mir-455  Sha-Mir-455  Sto-Mir-455  Tgu-Mir-455  Xtr-Mir-455 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr4: 63256867-63256923 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAUCCUGUGCUGCCCUCCCUGGUGUGAGCGUAUGUGCCUUUGGACUACAUCGUGAACGCAGCACCAUGCAGUCCACGGGCAUAUACACUUGCCUCAAGGUCUAUGUCAUCGAGGACC
Get precursor sequence
Structure
        10          20        30        40        50        
CAUCCUGUGCUGCCCUC-  -|  U UG  C          U      A   C UGAAC 
                  CC UGG G  AG GUAUGUGCCU UGGACU CAU G     \
                  GG ACU C  UC CAUAUACGGG ACCUGA GUA C     G
CCAGGAGCUACUGUAUCU  A^  C GU  A          C      C   C ACGAC 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere are mutliple Dicer cuts on the 3p arm relative to what is annotated here.
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-455_5p

MirBase accessionMIMAT0003485
Sequence
0- UAUGUGCCUUUGGACUACAUCG -22
Get sequence
Validated targets microrna.org: MIMAT0003485
TargetScanVert: mmu-miR-455-5p
miRDB: MIMAT0003485
Star sequence

Mmu-Mir-455_3p*

MirBase accessionMIMAT0003742
Sequence
35- AUGCAGUCCACGGGCAUAUACA -57
Get sequence
Validated targets microrna.org: MIMAT0003742
TargetScanVert: mmu-miR-455-3p.1
miRDB: MIMAT0003742