MirGeneDB

MirGeneDB ID

Mmu-Mir-29-P2a

Family name MIR-29 (all species)
Seed AGCACCA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-29b-1
Paralogues Mmu-Mir-29-P1a  Mmu-Mir-29-P1b  Mmu-Mir-29-P2b 
Orthologues Aae-Mir-29-P2  Aca-Mir-29-P2a  Ami-Mir-29-P2a-v1  Ami-Mir-29-P2a-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Bta-Mir-29-P2a  Cbr-Mir-29-P2  Cel-Mir-29-P2  Cfa-Mir-29-P2a  Cgi-Mir-29-P2  Cli-Mir-29-P2a  Cpi-Mir-29-P2a  Cpo-Mir-29-P2a  Cte-Mir-29-P2  Dan-Mir-29-P2  Dme-Mir-29-P2  Dmo-Mir-29-P2  Dno-Mir-29-P2a  Dre-Mir-29-P2a  Ete-Mir-29-P2a  Gga-Mir-29-P2a  Hme-Mir-29-P2  Hsa-Mir-29-P2a  Mdo-Mir-29-P2a  Mml-Mir-29-P2a  Oan-Mir-29-P2a  Ocu-Mir-29-P2a  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2a  Sha-Mir-29-P2a  Sko-Mir-29-P2  Spu-Mir-29-P2  Sto-Mir-29-P2a  Tca-Mir-29-P2  Tgu-Mir-29-P2a  Xtr-Mir-29-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr6: 31063025-31063088 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P2a)
Mir-29-P1a chr6: 31062673-31062732 [-] UCSC Ensembl
Mir-29-P2a chr6: 31063025-31063088 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAAAAACAGACGACAAAGCUUCUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGUGGAGAACUACUUCGCUGCCGACCG
Get precursor sequence
Structure
        10          20        30         40        50        60  
CAAAAACAGACGACAAAG--    U       -|         U      GU     UUUAAAU 
                    CUUC UCAGGAA GCUGGUUUCA AUGGUG  UUAGA       \
                    GAGG GGUUCUU UGACUAAAGU UACCAC  GAUCU       A
GCCAGCCGUCGCUUCAUCAA    U       G^         U      --     GUUAGUG 
  120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-29-P2a_5p*

MirBase accessionMIMAT0004523
Sequence
0- GCUGGUUUCAUAUGGUGGUUUAGA -24
Get sequence
Validated targets microrna.org: MIMAT0004523
TargetScanVert: mmu-miR-29b-1-5p
miRDB: MIMAT0004523
Mature sequence

Mmu-Mir-29-P2a_3p

MirBase accessionMIMAT0000127
Sequence
41- UAGCACCAUUUGAAAUCAGUGUU -64
Get sequence
Validated targets microrna.org: MIMAT0000127
TargetScanVert: mmu-miR-29b-3p
miRDB: MIMAT0000127