MirGeneDB

MirGeneDB ID

Mmu-Mir-29-P1a

Family name MIR-29 (all species)
Seed AGCACCA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-29a
Paralogues Mmu-Mir-29-P1b  Mmu-Mir-29-P2a  Mmu-Mir-29-P2b 
Orthologues Aca-Mir-29-P1a  Ami-Mir-29-P1a  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1a  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1a  Cpi-Mir-29-P1a  Cpo-Mir-29-P1a  Cte-Mir-29-P1  Dno-Mir-29-P1a  Dre-Mir-29-P1a  Ete-Mir-29-P1a  Gga-Mir-29-P1a  Hsa-Mir-29-P1a  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mml-Mir-29-P1a  Oan-Mir-29-P1a  Ocu-Mir-29-P1a  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1a  Sha-Mir-29-P1a  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1a  Tgu-Mir-29-P1a  Xtr-Mir-29-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr6: 31062673-31062732 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P1a)
Mir-29-P1a chr6: 31062673-31062732 [-] UCSC Ensembl
Mir-29-P2a chr6: 31063025-31063088 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAUGACCUCUUGUGACCCCUUAGAGGAUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAGAAUUUUCUAGCACCAUCUGAAAUCGGUUAUAAUGAUUGGGGAAGAGCACCGUUCAGCUG
Get precursor sequence
Structure
        10         20         30        40        50          
ACAUGACCUCUUGUGAC-    UAGAGG-|           UUU       C   GUCAAU 
                  CCCU       AUGACUGAUUUC   UGGUGUU AGA      \
                  GGGG       UAUUGGCUAAAG   ACCACGA UCU      A
GUCGACUUGCCACGAGAA    UUAGUAA^           UCU       -   UUUAAG 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-29-P1a_5p*

MirBase accessionMIMAT0004631
Sequence
0- ACUGAUUUCUUUUGGUGUUCAGA -23
Get sequence
Validated targets microrna.org: MIMAT0004631
TargetScanVert: mmu-miR-29a-5p
miRDB: MIMAT0004631
Mature sequence

Mmu-Mir-29-P1a_3p

MirBase accessionMIMAT0000535
Sequence
38- UAGCACCAUCUGAAAUCGGUUA -60
Get sequence
Validated targets microrna.org: MIMAT0000535
TargetScanVert: mmu-miR-29a-3p
miRDB: MIMAT0000535