MirGeneDB

MirGeneDB ID

Mmu-Mir-27-P1

Family name MIR-27 (all species)
Seed UCACAGU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-27a
Paralogues Mmu-Mir-27-P2 
Orthologues Aca-Mir-27-P1  Ami-Mir-27-P1  Bta-Mir-27-P1  Cfa-Mir-27-P1  Cpi-Mir-27-P1  Cpo-Mir-27-P1  Dno-Mir-27-P1  Dre-Mir-27-P1  Ete-Mir-27-P1  Hsa-Mir-27-P1  Mdo-Mir-27-P1  Mml-Mir-27-P1  Oan-Mir-27-P1  Rno-Mir-27-P1  Sha-Mir-27-P1  Sto-Mir-27-o1  Sto-Mir-27-P1  Tgu-Mir-27-P1  Xtr-Mir-27-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr8: 84208685-84208747 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P1)
Mir-23-P1 chr8: 84208527-84208584 [+] UCSC Ensembl
Mir-27-P1 chr8: 84208685-84208747 [+] UCSC Ensembl
Mir-24-P1 chr8: 84208839-84208896 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGCCUAUCAUGACAACUGGCCUGAGGAGCAGGGCUUAGCUGCUUGUGAGCAAGGUCCACAGCAAAGUCGUGUUCACAGUGGCUAAGUUCCGCCCCCUGGACCCCAUCUCCUCAGGCCGCUGC
Get precursor sequence
Structure
        10          20         30        40        50        60 
AAGCCUAUCAUGACAACU--  -| UGA  A  A         UG  U       AGGUCCAC 
                    GG CC   GG GC GGGCUUAGC  CU GUGAGCA        A
                    CC GG   CC CG CUUGAAUCG  GA CACUUGU        G
CGUCGCCGGACUCCUCUACC  A^ UCC  -  C         GU  -       GCUGAAAC 
 120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-27-P1_5p*

MirBase accessionMIMAT0004633
Sequence
0- AGGGCUUAGCUGCUUGUGAGCA -22
Get sequence
Validated targets microrna.org: MIMAT0004633
TargetScanVert: mmu-miR-27a-5p
miRDB: MIMAT0004633
Mature sequence

Mmu-Mir-27-P1_3p

MirBase accessionMIMAT0000537
Sequence
42- UUCACAGUGGCUAAGUUCCGC -63
Get sequence
Validated targets microrna.org: MIMAT0000537
TargetScanVert: mmu-miR-27a-3p
miRDB: MIMAT0000537