MirGeneDB

MirGeneDB ID

Mmu-Mir-26-P3

Family name MIR-26 (all species)
Seed UCAAGUA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-26a-1
Paralogues Mmu-Mir-26-P1  Mmu-Mir-26-P2 
Orthologues Aca-Mir-26-P3  Ami-Mir-26-P3  Bta-Mir-26-P3  Cfa-Mir-26-P3  Cli-Mir-26-P3  Cpi-Mir-26-P3  Cpo-Mir-26-P3  Dno-Mir-26-P3  Dre-Mir-26-P3a  Dre-Mir-26-P3b  Ete-Mir-26-P3  Gga-Mir-26-P3  Hsa-Mir-26-P3  Mdo-Mir-26-P3  Mml-Mir-26-P3  Oan-Mir-26-P3  Rno-Mir-26-P3  Sha-Mir-26-P3  Sto-Mir-26-P3  Tgu-Mir-26-P3c  Tgu-Mir-26-P3d  Xtr-Mir-26-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr9: 119031811-119031871 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCGAGGCCCUGGCGAAGGCCGUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAGGGGCCUAUUCUUGGUUACUUGCACGGGGACGCGGGCCUGGACGCCGGCAUCUGGG
Get precursor sequence
Structure
        10          20        30        40        50          
ACCGAGGCCCUGGCGAA-  -|    G      U         C          GUGCAGG 
                  GG CCGUG CCUCGU CAAGUAAUC AGGAUAGGCU       \
                  CC GGCGC GGGGCA GUUCAUUGG UCUUAUCCGG       U
GGGUCUACGGCCGCAGGU  G^    A      C         U          GGAACCC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-26-P3_5p

MirBase accessionMIMAT0000533
Sequence
0- UUCAAGUAAUCCAGGAUAGGCU -22
Get sequence
Validated targets microrna.org: MIMAT0000533
TargetScanVert: mmu-miR-26a-5p
miRDB: MIMAT0000533
Star sequence

Mmu-Mir-26-P3_3p*

MirBase accessionMIMAT0017020
Sequence
39- CCUAUUCUUGGUUACUUGCACG -61
Get sequence
Validated targets TargetScanVert: mmu-miR-26a-1-3p
miRDB: MIMAT0017020