MirGeneDB

MirGeneDB ID

Mmu-Mir-219-P1-as

Family name MIR-219 (all species)
Seed GACGUCC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-219c
Paralogues Mmu-Mir-219-P1  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) M. musculus
Node of Origin (family) Bilateria
Genome context
(mm10)
chr17: 34025012-34025073 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-219-P1-as)
Mir-219-P1 chr17: 34025009-34025072 [-] UCSC Ensembl
Mir-219-P1-as chr17: 34025012-34025073 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCCCCUCGAGGUUUGGGGGCGGCGGCUCGGGACGUCCAGACGCAACUCUCGGCCGGAGCCAGAGACUCGAGAAUUGCGUUUGGACAAUCAGGAGCCGCGGCCCGGGACGGGGAGAGAAGCG
Get precursor sequence
Structure
        10         20        30         40        50        60
UCCCCCUCGAGGUUUGG-    G       GG  C-|           C     GCCGGAG 
                  GGGC GCGGCUC  GA  GUCCAGACGCAA UCUCG       C
                  CCCG CGCCGAG  CU  CAGGUUUGCGUU AGAGC       C
GCGAAGAGAGGGGCAGGG    G       GA  AA^           A     UCAGAGA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-219-P1-as_5p

MirBase accessionMIMAT0029892
Sequence
0- GGACGUCCAGACGCAACUCUCG -22
Get sequence
Validated targets TargetScanVert: mmu-miR-219c-5p
miRDB: MIMAT0029892
Star sequence

Mmu-Mir-219-P1-as_3p*

MirBase accessionMIMAT0029893
Sequence
40- AGAAUUGCGUUUGGACAAUCAG -62
Get sequence
Validated targets TargetScanVert: mmu-miR-219c-3p
miRDB: MIMAT0029893