MirGeneDB

MirGeneDB ID

Mmu-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr1: 193507467-193507524 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAGCCCCAGACAAUCCAUGGGUCCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUUAUGCCAACCAGAUUUCAGUGGAGUGAAGCUCAGGAGGCAUGGAGCUGCCAGCGGUGGACUGA
Get precursor sequence
Structure
        10        20           30        40        50        
ACAGCCCCAGACAAUCCAUGG---|U       UC           C        UCUUA 
                        G CCUCUUG  CUUCAUUCCAC GGAGUCUG     U
                        C GGAGGAC  GAAGUGAGGUG CUUUAGAC     G
AGUCAGGUGGCGACCGUCGAGGUA^-       UC           A        CAACC 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-205-P1_5p

MirBase accessionMIMAT0000238
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Validated targets microrna.org: MIMAT0000238
TargetScanVert: mmu-miR-205-5p
miRDB: MIMAT0000238
Star sequence

Mmu-Mir-205-P1_3p*

MirBase accessionMIMAT0017003
Sequence
36- GAUUUCAGUGGAGUGAAGCUCA -58
Get sequence
Validated targets TargetScanVert: mmu-miR-205-3p
miRDB: MIMAT0017003