MirGeneDB

MirGeneDB ID

Mmu-Mir-194-P1

Family name MIR-194 (all species)
Seed GUAACAG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-194-2
Paralogues Mmu-Mir-194-P2 
Orthologues Aca-Mir-194-P1  Ami-Mir-194-P1  Bta-Mir-194-P1  Cfa-Mir-194-P1  Cpi-Mir-194-P1  Cpo-Mir-194-P1  Dno-Mir-194-P1  Dre-Mir-194-P1a  Dre-Mir-194-P1b  Ete-Mir-194-P1  Hsa-Mir-194-P1  Mml-Mir-194-P1  Oan-Mir-194-P1  Rno-Mir-194-P1  Sha-Mir-194-P1  Sto-Mir-194-P1  Xtr-Mir-194-P1 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr19: 6264658-6264715 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-194-P1)
Mir-194-P1 chr19: 6264658-6264715 [+] UCSC Ensembl
Mir-192-P1 chr19: 6264857-6264921 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGUGCUGACCCCCCGUGGCUCCCACCCUCUGUAACAGCAACUCCAUGUGGAAGUGCCCACUGGUUCCAGUGGGGCUGCUGUUAUCUGGGGUGGCGGCUAGUACCAGCAGAGGAAGAG
Get precursor sequence
Structure
        10          20        30        40        50         
CUGUGCUGACCCCCCGU--|   C       CU         A      G     GUGCC 
                   GGCU CCACCCU  GUAACAGCA CUCCAU UGGAA     \
                   UCGG GGUGGGG  UAUUGUCGU GGGGUG ACCUU     C
GAGAAGGAGACGACCAUGA^   C       UC         C      -     GGUCA 
      110       100        90        80        70         60
Deep sequencing
Go to detailed chart
CommentUnlike rat mouse appears to be a canonical Group 1 miRNA.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-194-P1_5p

MirBase accessionMIMAT0000224
Sequence
0- UGUAACAGCAACUCCAUGUGGAA -23
Get sequence
Validated targets microrna.org: MIMAT0000224
TargetScanVert: mmu-miR-194-5p
miRDB: MIMAT0000224
Star sequence

Mmu-Mir-194-P1_3p*

MirBase accessionMIMAT0017073
Sequence
36- CCAGUGGGGCUGCUGUUAUCUG -58
Get sequence
Validated targets TargetScanVert: mmu-miR-194-2-3p
miRDB: MIMAT0017073