MirGeneDB

MirGeneDB ID

Mmu-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-19b-2
Paralogues Mmu-Mir-19-P1  Mmu-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chrX: 52741991-52742056 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b chrX: 52741697-52741761 [-] UCSC Ensembl
Mir-92-P1b chrX: 52741853-52741913 [-] UCSC Ensembl
Mir-19-P2b chrX: 52741991-52742056 [-] UCSC Ensembl
Mir-17-P3b chrX: 52742121-52742181 [-] UCSC Ensembl
Mir-17-P2b chrX: 52742341-52742403 [-] UCSC Ensembl
Mir-17-P1b chrX: 52742505-52742563 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UACAGCGCAAGGACAUUGCUACUUACGAUUAGUUUUGCAGAUUUGCAGUUCAGCGUAUAUGUGAAUAUAUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGGGAAUGUGUACCUUUCUGCAUCGUA
Get precursor sequence
Structure
        10        20          30          40        50        60   
UACAGCGCAAGGACAUUGCUA--                  --|       GUU    GUAUAUGU 
                       CUUACGAUUAGUUUUGCA  GAUUUGCA   CAGC        \
                       GGGUGUUAGUCAAAACGU  CUAAACGU   GUCG        G
AUGCUACGUCUUUCCAUGUGUAA                  AC^       ---    GUAUAUAA 
    120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-19-P2b_5p*

MirBase accessionMIMAT0017010
Sequence
0- AGUUUUGCAGAUUUGCAGUUCAGC -24
Get sequence
Validated targets TargetScanVert: mmu-miR-19b-2-5p
miRDB: MIMAT0017010
Mature sequence

Mmu-Mir-19-P2b_3p

MirBase accessionMIMAT0000513
Sequence
43- UGUGCAAAUCCAUGCAAAACUGA -66
Get sequence
Validated targets microrna.org: MIMAT0000513
TargetScanVert: mmu-miR-19b-3p
miRDB: MIMAT0000513