MirGeneDB

MirGeneDB ID

Mmu-Mir-19-P1

Family name MIR-19 (all species)
Seed GUGCAAA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-19a
Paralogues Mmu-Mir-19-P2a  Mmu-Mir-19-P2b 
Orthologues Aca-Mir-19-P1  Ami-Mir-19-P1  Bta-Mir-19-P1  Cfa-Mir-19-P1  Cli-Mir-19-P1  Cpi-Mir-19-P1  Cpo-Mir-19-P1  Dno-Mir-19-P1  Dre-Mir-19-P1a  Ete-Mir-19-P1  Gga-Mir-19-P1  Hsa-Mir-19-P1  Mdo-Mir-19-P1  Mml-Mir-19-P1  Oan-Mir-19-P1  Ocu-Mir-19-P1  Rno-Mir-19-P1  Sha-Mir-19-P1  Sto-Mir-19-P1  Tgu-Mir-19-P1  Xtr-Mir-19-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr14: 115044013-115044070 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P1)
Mir-17-P1a chr14: 115043684-115043743 [+] UCSC Ensembl
Mir-17-P2a chr14: 115043867-115043930 [+] UCSC Ensembl
Mir-19-P1 chr14: 115044013-115044070 [+] UCSC Ensembl
Mir-17-P3a chr14: 115044183-115044241 [+] UCSC Ensembl
Mir-19-P2a chr14: 115044320-115044380 [+] UCSC Ensembl
Mir-92-P1a chr14: 115044437-115044497 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUCCAUAGUUGUGUUUGCAGCCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGCUAUUUACUUCAAGUGUUGU
Get precursor sequence
Structure
        10          20        30        40          50       
UCUCCAUAGUUGUGUUU--    C  U                 --|     U  AAGAA 
                   GCAG CC CUGUUAGUUUUGCAUAG  UUGCAC AC     G
                   CGUC GG GGUAGUCAAAACGUAUC  AACGUG UG     A
UGUUGUGAACUUCAUUUAU    C  U                 UA^     U  AUGUA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-19-P1_5p*

MirBase accessionMIMAT0004660
Sequence
0- AGUUUUGCAUAGUUGCACUAC -21
Get sequence
Validated targets microrna.org: MIMAT0004660
TargetScanVert: mmu-miR-19a-5p
miRDB: MIMAT0004660
Mature sequence

Mmu-Mir-19-P1_3p

MirBase accessionMIMAT0000651
Sequence
35- UGUGCAAAUCUAUGCAAAACUGA -58
Get sequence
Validated targets microrna.org: MIMAT0000651
TargetScanVert: mmu-miR-19a-3p
miRDB: MIMAT0000651